Supported file formats
This is a list of currently supported file formats in BioNumPy. Reading files with any of these extensions with bnp.open will make BioNumPy automatically detect the file type and read the data into an appropriate data structure (which will be a dataclass-like object with fields).
- vcf 
- bed 
- fasta / fa 
- bed 
- fastq / fq 
- gfa (limited support only) 
- gff 
- gtf 
- gff3 
- sam / bam 
Example
We open a bed file, read one chunk and print a description of that chunk:
import bionumpy as bnp
from bionumpy.io.delimited_buffers import DelimitedBuffer
data = bnp.open("example_data/test.bed")
chunk = data.read_chunk()
print(chunk)
The above example should work wih any of the supported file formats.
This shows us that we have a a chunk of 71 intervals, and we get to see the first of these:
Interval with 71 entries
               chromosome                    start                     stop
                       17                  7512371                  7512447
                       17                  7512377                  7512453
                       17                  7512393                  7512469
                       17                  7512420                  7512496
                       17                  7512422                  7512473
                       17                  7512425                  7512501
                       17                  7512428                  7512504
                       17                  7512474                  7512550
                       17                  7512537                  7512613
                       17                  7512559                  7512635
Reading a new file format
BioNumpy works well with popular file formats in biological data. However, if you have a custom file format that you would like to read into BioNumpy, you can implement a new buffer class that inherits from DelimitedBuffer and specify the dataclass that you would like to use to store the data. Here is an example of how you can implement a new buffer class for a custom file format:
We define a custom dataclass (e.g. MyCustomFormat here) that corresponds to the columns in our file format. We then define a new buffer class (e.g. MyCustomBuffer here) that inherits from DelimitedBuffer and specify the dataclass (e.g. MyCustomFormat here) that we would like to use. We can then use the bnp.open function to read all the files that have similar format.
from bionumpy.io.delimited_buffers import DelimitedBuffer
from bionumpy.bnpdataclass import bnpdataclass
import bionumpy as bnp
@bnpdataclass
class MyCustomFormat:
  dna: bnp.DNAEncoding
  amino_acid: bnp.AminoAcidEncoding
  v_gene: str
  j_gene: str
class MyCustomBuffer(DelimitedBuffer):
   dataclass = MyCustomFormat
my_sequence_data = bnp.open(filename="example_data/airr.tsv", buffer_type=MyCustomBuffer).read()
print(my_sequence_data)
MyCustomFormat with 100 entries
                         dna               amino_acid                   v_gene                   j_gene
     TGCGCCACCTGGGGGGACGAGCA               CATWGDEQYF                 TRBV10-2                  TRBJ2-7
     TGTGCCAGCTCACCTACGAATTC         CASSPTNSGSNYGYTF                   TRBV18                  TRBJ1-2
     TGCGGGCCCGTAATGAACACTGA              CGPVMNTEAFF                 TRBV10-2                  TRBJ1-1
     TGTGCCAGCAGTGAAGCGCGTCC         CASSEARPARMYGYTF                  TRBV6-1                  TRBJ1-2
     TGTGCCAGCAGTAGTGGGACAGG          CASSSGTGPDQPQHF                  TRBV6-3                  TRBJ1-5
     TGTGCCAGCAACCTAGCGGGGAA          CASNLAGKNTGELFF                  TRBV6-2                  TRBJ2-2
     TGTGCCAGCAGCCAACCGGGGGG         CASSQPGGSGNYGYTF                  TRBV4-2                  TRBJ1-2
     TGCGCCAGCAGCCGCGGCCTCAG           CASSRGLREETQYF                  TRBV5-1                  TRBJ2-5
     TGTGCCAGCAGCCAAGTCTCACG        CASSQVSRQDSSYEQYF                  TRBV4-2                  TRBJ2-7
     TGTGCCAGCAGGCCGGGACAGGG     CASRPGQGAPGWEDNYGYTF                   TRBV28                  TRBJ1-2